Friday, 26 September 2014

Events and Outings

During the Autumn there are a number of Fungus-related Events and Outings held around Carmarthenshire ( and further afield), that you are more than welcome to join.  Check out the list on our Events and Outings page opposite.

Thursday, 25 September 2014

Lycoperdon excipuliforme


A splendid line of Pestle Puffball on waste ground (an old powerstation building) at Burry Port harbour.  Several developing fb's are at the base and in front of the nearest puffball --- these have quite prominent 'spines'.

I managed to add a heading to this blog ---- learning!

Tuesday, 23 September 2014

Truffle from Pembrey

A Truffle from Pembrey Country Park !  This is the third species of truffle collected from Pembrey.  This one is a 'true' truffle , one of the ascomycete family rather than a 'false' truffle, a basidiomycete.  From the Kew book on truffles, I made this to be Tuber dryophila but sent one specimen to Carol Hobart in Sheffield as she has a particular interest in 'truffles'.  She says there is at present some confusion about some species and it could be T maculatum.  She is getting molecular  (DNA) studies done bit by bit on specimens she has so in time a correct name can be given to this find.  I did not have to dig for it as there were two close together on the soil surface --- looking like small pebbles.  Both had holes where insects had burrowed in to have a meal.  These did not have a strong smell.

A very uncommon Leccinum (bolete)





 Someone living in Llanelli, Gaynor Phillips, sent these pictures to Isabel Macho wondering what they might be.  They do not have gills but spongy pores so some kind of 'bolete'.  The stipes seem to have dark speckling like a Leccinum species.  The main clue is the tree which seems to be a species of Poplar.  







A fungus that fits would be Leccinum duriusculum Slate Bolete which is mycorrhizal with species of Poplar and the common name describes the cap colour.  An uncommon bolete.


Jelly Tooth, Pseudohydnum gelatinosum




 Those on the fungus-finding-walk in Pembrey Country Park last October saw JellyTooth Pseudohydnum gelatinosum and it is again on the same rotten conifer log.
 The teeth can just be seen beneath the cap edge. Some heavy rain would soon enable these to fill out as they are still rather small.



Paxillus rubicundulus, Alder Rollrim

On 28th Aug Colin showed nice pics of Gomphidius maculatus which has gills but is close to Boletus.  Another such genus is Paxillus.  The most common species is Paxillus involutus Brown Rollrim.  Another species, but far less common, is Alder Rollrim, P rubicundulus although the edge of the cap does not 'inroll' as it does with P involutus

This species is associated with Alder in damp situations as in the few wettish locations of Pembrey Forest.  The cap is somewhat scaly although not markedly so.  Running a finger-nail from sipe to gills separates the gills from the cap as can be done with the spongy pores of a bolete.

Monday, 22 September 2014

Earthstar Analysed

Last year, a mysterious round fungus appeared in the Great Glasshouse of the Botanic Garden.
Didn't do anything for months on end. What could it be? A visitor from Aberystwyth University kindly took a sample for DNA analysis. It eventually fruited and was clearly an earthstar. But what type?
Well, Gareth Griffiths from Aber Uni has kindly sent me the fiual analysis - just the common Geatrum triplex it turns out.  And here's the coding to prove it!!


TTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAATAACTCTCAATTTCAAATATTTTAGAATATCTGACATTGGACTTGGGCGTTGTCGTGTTTCTACGACTCGTCCTAAATGCATTAGCGATCTGCCCTGATCACACACAATGTGATAAGTAAAAAATAAAGCATTGTTATGGTTGGGTTTGAAAGATGGCTTCTAATCGTCGTAATGACAAATAAAAGACCATGTCGTTTGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTACGGCCGTCCGAGTTGTAATCTAGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTACGACACGGACTGCCAAGCGCTTTGTGATACACTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCAGAAATTCAGCTAGGCTTCTGCCTAATGTACTTTTCTGTGGGACGGGCCAACATCATTTTTGGCTGCCAAAAAAAGGTCGGAGGAAGGTGGCCCCTCCGGGTGTG