Monday, 22 September 2014

Earthstar Analysed

Last year, a mysterious round fungus appeared in the Great Glasshouse of the Botanic Garden.
Didn't do anything for months on end. What could it be? A visitor from Aberystwyth University kindly took a sample for DNA analysis. It eventually fruited and was clearly an earthstar. But what type?
Well, Gareth Griffiths from Aber Uni has kindly sent me the fiual analysis - just the common Geatrum triplex it turns out.  And here's the coding to prove it!!


TTGAACGCATCTTGCGCTCCTTGGTATTCCGAGGAGCATGCCTGTTTGAGTGTCGTGAATAACTCTCAATTTCAAATATTTTAGAATATCTGACATTGGACTTGGGCGTTGTCGTGTTTCTACGACTCGTCCTAAATGCATTAGCGATCTGCCCTGATCACACACAATGTGATAAGTAAAAAATAAAGCATTGTTATGGTTGGGTTTGAAAGATGGCTTCTAATCGTCGTAATGACAAATAAAAGACCATGTCGTTTGACCTCAAATCAGGCAGGACTACCCGCTGAACTTAAGCATATCAATAAGCGGAGGAAAAGAAACTAACAAGGATTCCCCTAGTAACGGCGAGTGAAGAGGGAAAAGCTCAAATTTAAAATCTGGCGGTCTACGGCCGTCCGAGTTGTAATCTAGAGAAGTGTTTTCCGCGCTGGACCGTGTACAAGTCCTTTGGAACAAGGCGTCATAGAGGGTGAGAATCCCGTCTACGACACGGACTGCCAAGCGCTTTGTGATACACTCTCAACGAGTCGAGTTGTTTGGGAATGCAGCTCAAAATGGGTGGTAAATTCCATCTAAAGCTAAATATTGGCGAAAGACCGATAGCGAACAAGTACCGTGAGGGAAAGATGAAAAGCACTTTGGAAAGAGAGTTAAACAGTACGTGAAATTGTTGAAAGGGAAACGCTTGAAGTCAGTCGCGTCTTCAGAAATTCAGCTAGGCTTCTGCCTAATGTACTTTTCTGTGGGACGGGCCAACATCATTTTTGGCTGCCAAAAAAAGGTCGGAGGAAGGTGGCCCCTCCGGGTGTG

2 comments:

  1. Yup! checked the coding just now - seems OK to me!
    Colin

    ReplyDelete
  2. Thanks Bruce. I did get one to develop but it did not look 'typical' G triplex although this seemed to be the consensus with those I asked. Good to know it WAS this species.
    Philip

    ReplyDelete